Review



tocilizumab  (Selleck Chemicals)


Bioz Verified Symbol Selleck Chemicals is a verified supplier
Bioz Manufacturer Symbol Selleck Chemicals manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Selleck Chemicals tocilizumab
    a MCF-7 and b T-47D cells were serum starved then incubated HBVP CM from 10 nM DTX with 0.1 µg/mL control IgG, 0.1 µg/mL <t>tocilizumab,</t> vehicle, or 10 nM DTX in combination as indicated for 24 hours. Cells were then lysed and subjected to immunoblotting using a pSTAT3 or STAT3 antibody. Fold change of pSTAT3 over total STAT3. Data is representative of n = 4 independent experiments. Mean ± s.e.m. shown. P values were calculated using a repeated measures one-way ANOVA with a ( a ) Sidak’s and ( b ) Tukey’s multiple comparisons test. * P ≤ 0.05, ** P ≤ 0.01. SimplyBlue SafeStains are shown for each representative membrane. HBVP = human brain vascular pericytes, and CM = conditioned media. DTX = docetaxel.
    Tocilizumab, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 94/100, based on 68 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/a2012/Tocilizumab/bio_rxiv__64898__2026__01__29__702661-176-0-12
    Average 94 stars, based on 68 article reviews
    tocilizumab - by Bioz Stars, 2026-09
    94/100 stars

    Images

    1) Product Images from "IL-6R blockade with tocilizumab disrupts pericyte– and tumor cell–driven IL-6/STAT3 signaling, enhancing docetaxel efficacy in ER+ breast cancer"

    Article Title: IL-6R blockade with tocilizumab disrupts pericyte– and tumor cell–driven IL-6/STAT3 signaling, enhancing docetaxel efficacy in ER+ breast cancer

    Journal: bioRxiv

    doi: 10.64898/2026.01.29.702661

    a MCF-7 and b T-47D cells were serum starved then incubated HBVP CM from 10 nM DTX with 0.1 µg/mL control IgG, 0.1 µg/mL tocilizumab, vehicle, or 10 nM DTX in combination as indicated for 24 hours. Cells were then lysed and subjected to immunoblotting using a pSTAT3 or STAT3 antibody. Fold change of pSTAT3 over total STAT3. Data is representative of n = 4 independent experiments. Mean ± s.e.m. shown. P values were calculated using a repeated measures one-way ANOVA with a ( a ) Sidak’s and ( b ) Tukey’s multiple comparisons test. * P ≤ 0.05, ** P ≤ 0.01. SimplyBlue SafeStains are shown for each representative membrane. HBVP = human brain vascular pericytes, and CM = conditioned media. DTX = docetaxel.
    Figure Legend Snippet: a MCF-7 and b T-47D cells were serum starved then incubated HBVP CM from 10 nM DTX with 0.1 µg/mL control IgG, 0.1 µg/mL tocilizumab, vehicle, or 10 nM DTX in combination as indicated for 24 hours. Cells were then lysed and subjected to immunoblotting using a pSTAT3 or STAT3 antibody. Fold change of pSTAT3 over total STAT3. Data is representative of n = 4 independent experiments. Mean ± s.e.m. shown. P values were calculated using a repeated measures one-way ANOVA with a ( a ) Sidak’s and ( b ) Tukey’s multiple comparisons test. * P ≤ 0.05, ** P ≤ 0.01. SimplyBlue SafeStains are shown for each representative membrane. HBVP = human brain vascular pericytes, and CM = conditioned media. DTX = docetaxel.

    Techniques Used: Incubation, Control, Western Blot, Membrane

    ( a – c ) Longitudinal spheroid growth of UVABCO178 ( a ), UVABCO176 ( b ), and UVABCO179 ( c ) over 14-16 days following treatment with control IgG (black), tocilizumab (0.1 µg/mL; cyan), DTX (10 nM; light pink), or the tocilizumab + DTX combination (purple). Lines represent model-fitted exponential growth curves for spheroid area over time, derived from linear regression of log-transformed area (log(Area) ∼ day) (n = 8 – 780 organoids per patient, time point, and condition). Bliss synergy excess for the tocilizumab + DTX combination are reported in each panel. Statistical significance between treatment groups is indicated (* P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001).( d – e ) Representative immunofluorescence images of spheroids from UVABCO178 ( d ) and UVABCO179 ( e ) following treatment with control IgG, tocilizumab, DTX, or the combination. Staining includes DAPI (nuclei, white), EdU (proliferation, magenta), pSTAT3 (IL-6 signaling, red), and NucView488 (NV488; apoptosis, green). Scale bars, 100 µm. DTX = docetaxel.
    Figure Legend Snippet: ( a – c ) Longitudinal spheroid growth of UVABCO178 ( a ), UVABCO176 ( b ), and UVABCO179 ( c ) over 14-16 days following treatment with control IgG (black), tocilizumab (0.1 µg/mL; cyan), DTX (10 nM; light pink), or the tocilizumab + DTX combination (purple). Lines represent model-fitted exponential growth curves for spheroid area over time, derived from linear regression of log-transformed area (log(Area) ∼ day) (n = 8 – 780 organoids per patient, time point, and condition). Bliss synergy excess for the tocilizumab + DTX combination are reported in each panel. Statistical significance between treatment groups is indicated (* P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001).( d – e ) Representative immunofluorescence images of spheroids from UVABCO178 ( d ) and UVABCO179 ( e ) following treatment with control IgG, tocilizumab, DTX, or the combination. Staining includes DAPI (nuclei, white), EdU (proliferation, magenta), pSTAT3 (IL-6 signaling, red), and NucView488 (NV488; apoptosis, green). Scale bars, 100 µm. DTX = docetaxel.

    Techniques Used: Control, Derivative Assay, Transformation Assay, Immunofluorescence, Staining

    a Docetaxel directly impacts pericytes within the tumor microenvironment, inducing secretion of IL-6. Pericyte-derived IL-6 engages the IL-6R complex (IL-6Rα/IL-6Rβ) on ER+ breast cancer cells, activating JAK/STAT3 signaling and promoting anti-apoptotic signaling, cancer cell survival, and chemoresistance. b Pharmacologic inhibition of IL-6R with tocilizumab disrupts IL-6 mediated signaling between pericytes and cancer cells. IL-6R blockade attenuates STAT3 activation, resulting in reduced anti-apoptotic signaling and decreased chemoresistance in ER+ breast cancer cells treated with docetaxel. Generated from BioRender.
    Figure Legend Snippet: a Docetaxel directly impacts pericytes within the tumor microenvironment, inducing secretion of IL-6. Pericyte-derived IL-6 engages the IL-6R complex (IL-6Rα/IL-6Rβ) on ER+ breast cancer cells, activating JAK/STAT3 signaling and promoting anti-apoptotic signaling, cancer cell survival, and chemoresistance. b Pharmacologic inhibition of IL-6R with tocilizumab disrupts IL-6 mediated signaling between pericytes and cancer cells. IL-6R blockade attenuates STAT3 activation, resulting in reduced anti-apoptotic signaling and decreased chemoresistance in ER+ breast cancer cells treated with docetaxel. Generated from BioRender.

    Techniques Used: Derivative Assay, Inhibition, Activation Assay, Generated

    Related Articles

    other:


    Article Title: AKT and EZH2 inhibitors kill TNBCs by hijacking mechanisms of involution.
    Article Snippet: STING agonist ADU-S100 (MIW815) was supplemented at 50 μM (CT-ADUS100, Chemietek).

    Article Title: AKT and EZH2 inhibitors kill TNBCs by hijacking mechanisms of involution
    Article Snippet: Anti-IL-6R antibody is tocilizumab and was supplemented at 50 μg ml −1 (A2012-5MG, Selleckchem).

    Article Title: AKT and EZH2 inhibitors kill TNBCs by hijacking mechanisms of involution.
    Article Snippet: Anti-IL-6R antibody is tocilizumab and was supplemented at 50 μg ml−1 (A2012-5MG, Selleckchem).

    Recombinant:

    Article Title: FTO SUMOylation regulates the differentiation of bone marrow mesenchymal stromal cells in inflammatory bowel disease-induced bone loss.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GAPDH (14C10) antibody Cell Signaling Technology Cat# 2118; RRID: AB_561053 Rabbit anti-Histone-H3 antibody Cell Signaling Technology Cat# 9715; RRID: AB_331563 Rabbit anti-FTO (D2V1I) antibody Cell Signaling Technology Cat# 45980; RRID: AB_2799294 Rabbit anti-ALKBH5 (E5Y7C) antibody Cell Signaling Technology Cat# 80283 ; RRID: AB_3094894 Rabbit anti-METTL3 (E3F2A) antibody Cell Signaling Technology Cat# 86132; RRID: AB_2800072 Rabbit anti-METTL14 (D8K8W) antibody Cell Signaling Technology Cat# 51104; RRID: AB_2799383 Rabbit anti-HA antibody Abcam Cat# ab9110; RRID: AB_307019 Rabbit anti-Flag (D6W5B) antibody Cell Signaling Technology Cat# 14793; RRID: AB_2572291 Rabbit anti-Histone antibody Abcam Cat# ab1791; RRID: AB_302613 Rabbit anti-SUMO1 antibody Cell Signaling Technology Cat# 4930; RRID: AB_10698887 Mouse anti-SUMO2/3 [8A2]antibody Abcam Cat# ab81371; RRID: AB_1658424 Rabbit anti-GFP antibody Abcam Cat# ab290; RRID: AB_303395 Rabbit anti-m 6 A (D9D9W) antibody Cell Signaling Technology Cat# 56593; RRID: AB_2799515 Rabbit anti-Myc (D84C12) antibody Cell Signaling Technology Cat# 5605; RRID: AB_1903938 Chemicals, peptides, and recombinant proteins Tocilizumab Selleck Cat# A2012; CAS: 375823-41-9 L-Ascorbic Acid Sigma-Aldrich Cat# A4403; CAS: 50-81-7 β-Glycerophosphate Sigma-Aldrich Cat# G9422; CAS: 154804-51-0 Dexamethasone Sigma-Aldrich Cat# D4902; CAS: 50-02-2 Indomethacin Sigma-Aldrich Cat# 405268; CAS: 53-86-1 3-Isobutyl-1-Methylxanthine Sigma-Aldrich Cat# I7018; CAS: 28822-58-4 Insulin Sigma-Aldrich Cat# I3536; CAS: 11061-68-0 Calcein Sigma-Aldrich Cat# 56496; CAS: 148504-34-1 Dextran Sodium Sulfate MP Biomedicals Cat# 02160110-CF; CAS: 9011-18-1 Deposited data m 6 A sequence of BMSCs Gene Expression Omnibus GSE298548 Experimental models: Organisms/strains Primary murine osteoblasts N/A N/A Primary murine BMSCs N/A N/A 293T cells N/A N/A Mouse: C57BL/6L SLACCAS N/A Oligounucleotides Mouse Gapdh qpcr primers F: ACCCTTAAGAGGGATGCTGC R: ATCCGTTCACACCGACCTTC N/A Mouse Fto qpcr primers F: GGTACCCAAAATGCCAACTCC R: AGCTCACGTAACGACACTGG N/A Mouse Alkbh5 qpcr primers F: GTGGTGAGAGAAAGCCTGACT R: AGCCATCAATCAAGGGGTGT N/A Mouse Mettl3 qpcr primers F: TCATCTTGGCTCTATCCGGC R: CGTGTCCGACATCCTAGCTC N/A Mouse Mettl4 qpcr primers F: AAGCGAGGGTTTGTTTCCGA R: GACAGCCTCTCCTACCGTCA N/A Mouse Mettl14 qpcr primers F: ACCCTTACGAATACAGCGTGG R: TGTAGAAAGGCAACAGCACGA N/A (Continued on next page) 14 Cell Reports 44, 115953, July 22, 2025 .. 8-week male c57BL/6 mice were bought from the SLAC Laboratory Animal Company (Shanghai, China).

    Sequencing:

    Article Title: FTO SUMOylation regulates the differentiation of bone marrow mesenchymal stromal cells in inflammatory bowel disease-induced bone loss.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GAPDH (14C10) antibody Cell Signaling Technology Cat# 2118; RRID: AB_561053 Rabbit anti-Histone-H3 antibody Cell Signaling Technology Cat# 9715; RRID: AB_331563 Rabbit anti-FTO (D2V1I) antibody Cell Signaling Technology Cat# 45980; RRID: AB_2799294 Rabbit anti-ALKBH5 (E5Y7C) antibody Cell Signaling Technology Cat# 80283 ; RRID: AB_3094894 Rabbit anti-METTL3 (E3F2A) antibody Cell Signaling Technology Cat# 86132; RRID: AB_2800072 Rabbit anti-METTL14 (D8K8W) antibody Cell Signaling Technology Cat# 51104; RRID: AB_2799383 Rabbit anti-HA antibody Abcam Cat# ab9110; RRID: AB_307019 Rabbit anti-Flag (D6W5B) antibody Cell Signaling Technology Cat# 14793; RRID: AB_2572291 Rabbit anti-Histone antibody Abcam Cat# ab1791; RRID: AB_302613 Rabbit anti-SUMO1 antibody Cell Signaling Technology Cat# 4930; RRID: AB_10698887 Mouse anti-SUMO2/3 [8A2]antibody Abcam Cat# ab81371; RRID: AB_1658424 Rabbit anti-GFP antibody Abcam Cat# ab290; RRID: AB_303395 Rabbit anti-m 6 A (D9D9W) antibody Cell Signaling Technology Cat# 56593; RRID: AB_2799515 Rabbit anti-Myc (D84C12) antibody Cell Signaling Technology Cat# 5605; RRID: AB_1903938 Chemicals, peptides, and recombinant proteins Tocilizumab Selleck Cat# A2012; CAS: 375823-41-9 L-Ascorbic Acid Sigma-Aldrich Cat# A4403; CAS: 50-81-7 β-Glycerophosphate Sigma-Aldrich Cat# G9422; CAS: 154804-51-0 Dexamethasone Sigma-Aldrich Cat# D4902; CAS: 50-02-2 Indomethacin Sigma-Aldrich Cat# 405268; CAS: 53-86-1 3-Isobutyl-1-Methylxanthine Sigma-Aldrich Cat# I7018; CAS: 28822-58-4 Insulin Sigma-Aldrich Cat# I3536; CAS: 11061-68-0 Calcein Sigma-Aldrich Cat# 56496; CAS: 148504-34-1 Dextran Sodium Sulfate MP Biomedicals Cat# 02160110-CF; CAS: 9011-18-1 Deposited data m 6 A sequence of BMSCs Gene Expression Omnibus GSE298548 Experimental models: Organisms/strains Primary murine osteoblasts N/A N/A Primary murine BMSCs N/A N/A 293T cells N/A N/A Mouse: C57BL/6L SLACCAS N/A Oligounucleotides Mouse Gapdh qpcr primers F: ACCCTTAAGAGGGATGCTGC R: ATCCGTTCACACCGACCTTC N/A Mouse Fto qpcr primers F: GGTACCCAAAATGCCAACTCC R: AGCTCACGTAACGACACTGG N/A Mouse Alkbh5 qpcr primers F: GTGGTGAGAGAAAGCCTGACT R: AGCCATCAATCAAGGGGTGT N/A Mouse Mettl3 qpcr primers F: TCATCTTGGCTCTATCCGGC R: CGTGTCCGACATCCTAGCTC N/A Mouse Mettl4 qpcr primers F: AAGCGAGGGTTTGTTTCCGA R: GACAGCCTCTCCTACCGTCA N/A Mouse Mettl14 qpcr primers F: ACCCTTACGAATACAGCGTGG R: TGTAGAAAGGCAACAGCACGA N/A (Continued on next page) 14 Cell Reports 44, 115953, July 22, 2025 .. 8-week male c57BL/6 mice were bought from the SLAC Laboratory Animal Company (Shanghai, China).

    Gene Expression:

    Article Title: FTO SUMOylation regulates the differentiation of bone marrow mesenchymal stromal cells in inflammatory bowel disease-induced bone loss.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GAPDH (14C10) antibody Cell Signaling Technology Cat# 2118; RRID: AB_561053 Rabbit anti-Histone-H3 antibody Cell Signaling Technology Cat# 9715; RRID: AB_331563 Rabbit anti-FTO (D2V1I) antibody Cell Signaling Technology Cat# 45980; RRID: AB_2799294 Rabbit anti-ALKBH5 (E5Y7C) antibody Cell Signaling Technology Cat# 80283 ; RRID: AB_3094894 Rabbit anti-METTL3 (E3F2A) antibody Cell Signaling Technology Cat# 86132; RRID: AB_2800072 Rabbit anti-METTL14 (D8K8W) antibody Cell Signaling Technology Cat# 51104; RRID: AB_2799383 Rabbit anti-HA antibody Abcam Cat# ab9110; RRID: AB_307019 Rabbit anti-Flag (D6W5B) antibody Cell Signaling Technology Cat# 14793; RRID: AB_2572291 Rabbit anti-Histone antibody Abcam Cat# ab1791; RRID: AB_302613 Rabbit anti-SUMO1 antibody Cell Signaling Technology Cat# 4930; RRID: AB_10698887 Mouse anti-SUMO2/3 [8A2]antibody Abcam Cat# ab81371; RRID: AB_1658424 Rabbit anti-GFP antibody Abcam Cat# ab290; RRID: AB_303395 Rabbit anti-m 6 A (D9D9W) antibody Cell Signaling Technology Cat# 56593; RRID: AB_2799515 Rabbit anti-Myc (D84C12) antibody Cell Signaling Technology Cat# 5605; RRID: AB_1903938 Chemicals, peptides, and recombinant proteins Tocilizumab Selleck Cat# A2012; CAS: 375823-41-9 L-Ascorbic Acid Sigma-Aldrich Cat# A4403; CAS: 50-81-7 β-Glycerophosphate Sigma-Aldrich Cat# G9422; CAS: 154804-51-0 Dexamethasone Sigma-Aldrich Cat# D4902; CAS: 50-02-2 Indomethacin Sigma-Aldrich Cat# 405268; CAS: 53-86-1 3-Isobutyl-1-Methylxanthine Sigma-Aldrich Cat# I7018; CAS: 28822-58-4 Insulin Sigma-Aldrich Cat# I3536; CAS: 11061-68-0 Calcein Sigma-Aldrich Cat# 56496; CAS: 148504-34-1 Dextran Sodium Sulfate MP Biomedicals Cat# 02160110-CF; CAS: 9011-18-1 Deposited data m 6 A sequence of BMSCs Gene Expression Omnibus GSE298548 Experimental models: Organisms/strains Primary murine osteoblasts N/A N/A Primary murine BMSCs N/A N/A 293T cells N/A N/A Mouse: C57BL/6L SLACCAS N/A Oligounucleotides Mouse Gapdh qpcr primers F: ACCCTTAAGAGGGATGCTGC R: ATCCGTTCACACCGACCTTC N/A Mouse Fto qpcr primers F: GGTACCCAAAATGCCAACTCC R: AGCTCACGTAACGACACTGG N/A Mouse Alkbh5 qpcr primers F: GTGGTGAGAGAAAGCCTGACT R: AGCCATCAATCAAGGGGTGT N/A Mouse Mettl3 qpcr primers F: TCATCTTGGCTCTATCCGGC R: CGTGTCCGACATCCTAGCTC N/A Mouse Mettl4 qpcr primers F: AAGCGAGGGTTTGTTTCCGA R: GACAGCCTCTCCTACCGTCA N/A Mouse Mettl14 qpcr primers F: ACCCTTACGAATACAGCGTGG R: TGTAGAAAGGCAACAGCACGA N/A (Continued on next page) 14 Cell Reports 44, 115953, July 22, 2025 .. 8-week male c57BL/6 mice were bought from the SLAC Laboratory Animal Company (Shanghai, China).



    Similar Products

    95
    MedChemExpress a2012 52 combinations atezolizumab bevacizumab
    A2012 52 Combinations Atezolizumab Bevacizumab, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/a2012/Atezolizumab/pm41461636-310-46-78
    Average 95 stars, based on 1 article reviews
    a2012 52 combinations atezolizumab bevacizumab - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    94
    Selleck Chemicals tocilizumab
    a MCF-7 and b T-47D cells were serum starved then incubated HBVP CM from 10 nM DTX with 0.1 µg/mL control IgG, 0.1 µg/mL <t>tocilizumab,</t> vehicle, or 10 nM DTX in combination as indicated for 24 hours. Cells were then lysed and subjected to immunoblotting using a pSTAT3 or STAT3 antibody. Fold change of pSTAT3 over total STAT3. Data is representative of n = 4 independent experiments. Mean ± s.e.m. shown. P values were calculated using a repeated measures one-way ANOVA with a ( a ) Sidak’s and ( b ) Tukey’s multiple comparisons test. * P ≤ 0.05, ** P ≤ 0.01. SimplyBlue SafeStains are shown for each representative membrane. HBVP = human brain vascular pericytes, and CM = conditioned media. DTX = docetaxel.
    Tocilizumab, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/a2012/Tocilizumab/bio_rxiv__64898__2026__01__29__702661-176-0-12
    Average 94 stars, based on 1 article reviews
    tocilizumab - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    Selleck Chemicals anti il 6r
    a MCF-7 and b T-47D cells were serum starved then incubated HBVP CM from 10 nM DTX with 0.1 µg/mL control IgG, 0.1 µg/mL <t>tocilizumab,</t> vehicle, or 10 nM DTX in combination as indicated for 24 hours. Cells were then lysed and subjected to immunoblotting using a pSTAT3 or STAT3 antibody. Fold change of pSTAT3 over total STAT3. Data is representative of n = 4 independent experiments. Mean ± s.e.m. shown. P values were calculated using a repeated measures one-way ANOVA with a ( a ) Sidak’s and ( b ) Tukey’s multiple comparisons test. * P ≤ 0.05, ** P ≤ 0.01. SimplyBlue SafeStains are shown for each representative membrane. HBVP = human brain vascular pericytes, and CM = conditioned media. DTX = docetaxel.
    Anti Il 6r, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/a2012/Tocilizumab/pmc12847976-29-5-7
    Average 94 stars, based on 1 article reviews
    anti il 6r - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    Selleck Chemicals a2012
    a MCF-7 and b T-47D cells were serum starved then incubated HBVP CM from 10 nM DTX with 0.1 µg/mL control IgG, 0.1 µg/mL <t>tocilizumab,</t> vehicle, or 10 nM DTX in combination as indicated for 24 hours. Cells were then lysed and subjected to immunoblotting using a pSTAT3 or STAT3 antibody. Fold change of pSTAT3 over total STAT3. Data is representative of n = 4 independent experiments. Mean ± s.e.m. shown. P values were calculated using a repeated measures one-way ANOVA with a ( a ) Sidak’s and ( b ) Tukey’s multiple comparisons test. * P ≤ 0.05, ** P ≤ 0.01. SimplyBlue SafeStains are shown for each representative membrane. HBVP = human brain vascular pericytes, and CM = conditioned media. DTX = docetaxel.
    A2012, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/a2012/Tocilizumab/pmc12847976-29-9-7
    Average 94 stars, based on 1 article reviews
    a2012 - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    96
    Selleck Chemicals a2012 52 combinations atezolizumab bevacizumab
    a MCF-7 and b T-47D cells were serum starved then incubated HBVP CM from 10 nM DTX with 0.1 µg/mL control IgG, 0.1 µg/mL <t>tocilizumab,</t> vehicle, or 10 nM DTX in combination as indicated for 24 hours. Cells were then lysed and subjected to immunoblotting using a pSTAT3 or STAT3 antibody. Fold change of pSTAT3 over total STAT3. Data is representative of n = 4 independent experiments. Mean ± s.e.m. shown. P values were calculated using a repeated measures one-way ANOVA with a ( a ) Sidak’s and ( b ) Tukey’s multiple comparisons test. * P ≤ 0.05, ** P ≤ 0.01. SimplyBlue SafeStains are shown for each representative membrane. HBVP = human brain vascular pericytes, and CM = conditioned media. DTX = docetaxel.
    A2012 52 Combinations Atezolizumab Bevacizumab, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/a2012/Atezolizumab/pm41461636-310-46-55
    Average 96 stars, based on 1 article reviews
    a2012 52 combinations atezolizumab bevacizumab - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    94
    Selleck Chemicals a2006 51 tocilizumab
    a MCF-7 and b T-47D cells were serum starved then incubated HBVP CM from 10 nM DTX with 0.1 µg/mL control IgG, 0.1 µg/mL <t>tocilizumab,</t> vehicle, or 10 nM DTX in combination as indicated for 24 hours. Cells were then lysed and subjected to immunoblotting using a pSTAT3 or STAT3 antibody. Fold change of pSTAT3 over total STAT3. Data is representative of n = 4 independent experiments. Mean ± s.e.m. shown. P values were calculated using a repeated measures one-way ANOVA with a ( a ) Sidak’s and ( b ) Tukey’s multiple comparisons test. * P ≤ 0.05, ** P ≤ 0.01. SimplyBlue SafeStains are shown for each representative membrane. HBVP = human brain vascular pericytes, and CM = conditioned media. DTX = docetaxel.
    A2006 51 Tocilizumab, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/a2012/Tocilizumab/pm41461636-310-39-44
    Average 94 stars, based on 1 article reviews
    a2006 51 tocilizumab - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    Selleck Chemicals tocilizumab tcz treatment
    ( a ) Quantification of TEER levels shows a reduction in barrier integrity following incubation with poly(I:C) and a recovery after treatment with the CAR factors (3 biological independent experiments). ( b ) Quantification of NaFl levels confirms the recovery after treatment with the CAR factors (n=3 biological independent experiments). ( c ) Representative images and reduction of human IgG+ puncta in hPSC-derived neurons following incubation with the CAR factors (5 fields; n=3 biological independent experiments). ( d ) CAR factors reverse the mesenchymal cell transition induced by Poly(I:C). ( e ) Rescue of TEER values after treatment with <t>tocilizumab</t> <t>(TCZ)</t> (n=3 biological independent experiments). ( f ) Quantification of NaFl levels confirms the recovery after treatment with the TCZ (n=3 biological independent experiments). ( g ) Representative images and quantification of human IgG+ puncta in hPSC-derived neuronal cultures following incubation with poly(I:C) with or without TCZ (5 fields; n=3 biological independent experiments). ( h ) TCZ treatment is sufficient to rescue the endothelial-specific gene expression as confirmed by qPCR analysis. Values are mean ± SEM. *p < 0.05, ****p < 0.0001. Statistical analysis is performed using one-way ANOVA followed by Tukey post-test. Scale bars, 100 µm. CAR: CHIR99021 (C), db-cAMP (A), RepSox (R); TCZ: Tocilizumab.
    Tocilizumab Tcz Treatment, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/a2012/Tocilizumab/bio_rxiv__64898__2025__12__21__695793-308-4-16
    Average 94 stars, based on 1 article reviews
    tocilizumab tcz treatment - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    Image Search Results


    a MCF-7 and b T-47D cells were serum starved then incubated HBVP CM from 10 nM DTX with 0.1 µg/mL control IgG, 0.1 µg/mL tocilizumab, vehicle, or 10 nM DTX in combination as indicated for 24 hours. Cells were then lysed and subjected to immunoblotting using a pSTAT3 or STAT3 antibody. Fold change of pSTAT3 over total STAT3. Data is representative of n = 4 independent experiments. Mean ± s.e.m. shown. P values were calculated using a repeated measures one-way ANOVA with a ( a ) Sidak’s and ( b ) Tukey’s multiple comparisons test. * P ≤ 0.05, ** P ≤ 0.01. SimplyBlue SafeStains are shown for each representative membrane. HBVP = human brain vascular pericytes, and CM = conditioned media. DTX = docetaxel.

    Journal: bioRxiv

    Article Title: IL-6R blockade with tocilizumab disrupts pericyte– and tumor cell–driven IL-6/STAT3 signaling, enhancing docetaxel efficacy in ER+ breast cancer

    doi: 10.64898/2026.01.29.702661

    Figure Lengend Snippet: a MCF-7 and b T-47D cells were serum starved then incubated HBVP CM from 10 nM DTX with 0.1 µg/mL control IgG, 0.1 µg/mL tocilizumab, vehicle, or 10 nM DTX in combination as indicated for 24 hours. Cells were then lysed and subjected to immunoblotting using a pSTAT3 or STAT3 antibody. Fold change of pSTAT3 over total STAT3. Data is representative of n = 4 independent experiments. Mean ± s.e.m. shown. P values were calculated using a repeated measures one-way ANOVA with a ( a ) Sidak’s and ( b ) Tukey’s multiple comparisons test. * P ≤ 0.05, ** P ≤ 0.01. SimplyBlue SafeStains are shown for each representative membrane. HBVP = human brain vascular pericytes, and CM = conditioned media. DTX = docetaxel.

    Article Snippet: Tocilizumab (#A2012) and human IgG isotype control (#A2051, RRID:AB_3096062)) were purchased from SelleckChem, while docetaxel (DTX) (#01885-5MG-F) and bovine serum albumin (#A193325G) were purchased from Sigma Aldrich.

    Techniques: Incubation, Control, Western Blot, Membrane

    ( a – c ) Longitudinal spheroid growth of UVABCO178 ( a ), UVABCO176 ( b ), and UVABCO179 ( c ) over 14-16 days following treatment with control IgG (black), tocilizumab (0.1 µg/mL; cyan), DTX (10 nM; light pink), or the tocilizumab + DTX combination (purple). Lines represent model-fitted exponential growth curves for spheroid area over time, derived from linear regression of log-transformed area (log(Area) ∼ day) (n = 8 – 780 organoids per patient, time point, and condition). Bliss synergy excess for the tocilizumab + DTX combination are reported in each panel. Statistical significance between treatment groups is indicated (* P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001).( d – e ) Representative immunofluorescence images of spheroids from UVABCO178 ( d ) and UVABCO179 ( e ) following treatment with control IgG, tocilizumab, DTX, or the combination. Staining includes DAPI (nuclei, white), EdU (proliferation, magenta), pSTAT3 (IL-6 signaling, red), and NucView488 (NV488; apoptosis, green). Scale bars, 100 µm. DTX = docetaxel.

    Journal: bioRxiv

    Article Title: IL-6R blockade with tocilizumab disrupts pericyte– and tumor cell–driven IL-6/STAT3 signaling, enhancing docetaxel efficacy in ER+ breast cancer

    doi: 10.64898/2026.01.29.702661

    Figure Lengend Snippet: ( a – c ) Longitudinal spheroid growth of UVABCO178 ( a ), UVABCO176 ( b ), and UVABCO179 ( c ) over 14-16 days following treatment with control IgG (black), tocilizumab (0.1 µg/mL; cyan), DTX (10 nM; light pink), or the tocilizumab + DTX combination (purple). Lines represent model-fitted exponential growth curves for spheroid area over time, derived from linear regression of log-transformed area (log(Area) ∼ day) (n = 8 – 780 organoids per patient, time point, and condition). Bliss synergy excess for the tocilizumab + DTX combination are reported in each panel. Statistical significance between treatment groups is indicated (* P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001).( d – e ) Representative immunofluorescence images of spheroids from UVABCO178 ( d ) and UVABCO179 ( e ) following treatment with control IgG, tocilizumab, DTX, or the combination. Staining includes DAPI (nuclei, white), EdU (proliferation, magenta), pSTAT3 (IL-6 signaling, red), and NucView488 (NV488; apoptosis, green). Scale bars, 100 µm. DTX = docetaxel.

    Article Snippet: Tocilizumab (#A2012) and human IgG isotype control (#A2051, RRID:AB_3096062)) were purchased from SelleckChem, while docetaxel (DTX) (#01885-5MG-F) and bovine serum albumin (#A193325G) were purchased from Sigma Aldrich.

    Techniques: Control, Derivative Assay, Transformation Assay, Immunofluorescence, Staining

    a Docetaxel directly impacts pericytes within the tumor microenvironment, inducing secretion of IL-6. Pericyte-derived IL-6 engages the IL-6R complex (IL-6Rα/IL-6Rβ) on ER+ breast cancer cells, activating JAK/STAT3 signaling and promoting anti-apoptotic signaling, cancer cell survival, and chemoresistance. b Pharmacologic inhibition of IL-6R with tocilizumab disrupts IL-6 mediated signaling between pericytes and cancer cells. IL-6R blockade attenuates STAT3 activation, resulting in reduced anti-apoptotic signaling and decreased chemoresistance in ER+ breast cancer cells treated with docetaxel. Generated from BioRender.

    Journal: bioRxiv

    Article Title: IL-6R blockade with tocilizumab disrupts pericyte– and tumor cell–driven IL-6/STAT3 signaling, enhancing docetaxel efficacy in ER+ breast cancer

    doi: 10.64898/2026.01.29.702661

    Figure Lengend Snippet: a Docetaxel directly impacts pericytes within the tumor microenvironment, inducing secretion of IL-6. Pericyte-derived IL-6 engages the IL-6R complex (IL-6Rα/IL-6Rβ) on ER+ breast cancer cells, activating JAK/STAT3 signaling and promoting anti-apoptotic signaling, cancer cell survival, and chemoresistance. b Pharmacologic inhibition of IL-6R with tocilizumab disrupts IL-6 mediated signaling between pericytes and cancer cells. IL-6R blockade attenuates STAT3 activation, resulting in reduced anti-apoptotic signaling and decreased chemoresistance in ER+ breast cancer cells treated with docetaxel. Generated from BioRender.

    Article Snippet: Tocilizumab (#A2012) and human IgG isotype control (#A2051, RRID:AB_3096062)) were purchased from SelleckChem, while docetaxel (DTX) (#01885-5MG-F) and bovine serum albumin (#A193325G) were purchased from Sigma Aldrich.

    Techniques: Derivative Assay, Inhibition, Activation Assay, Generated

    ( a ) Quantification of TEER levels shows a reduction in barrier integrity following incubation with poly(I:C) and a recovery after treatment with the CAR factors (3 biological independent experiments). ( b ) Quantification of NaFl levels confirms the recovery after treatment with the CAR factors (n=3 biological independent experiments). ( c ) Representative images and reduction of human IgG+ puncta in hPSC-derived neurons following incubation with the CAR factors (5 fields; n=3 biological independent experiments). ( d ) CAR factors reverse the mesenchymal cell transition induced by Poly(I:C). ( e ) Rescue of TEER values after treatment with tocilizumab (TCZ) (n=3 biological independent experiments). ( f ) Quantification of NaFl levels confirms the recovery after treatment with the TCZ (n=3 biological independent experiments). ( g ) Representative images and quantification of human IgG+ puncta in hPSC-derived neuronal cultures following incubation with poly(I:C) with or without TCZ (5 fields; n=3 biological independent experiments). ( h ) TCZ treatment is sufficient to rescue the endothelial-specific gene expression as confirmed by qPCR analysis. Values are mean ± SEM. *p < 0.05, ****p < 0.0001. Statistical analysis is performed using one-way ANOVA followed by Tukey post-test. Scale bars, 100 µm. CAR: CHIR99021 (C), db-cAMP (A), RepSox (R); TCZ: Tocilizumab.

    Journal: bioRxiv

    Article Title: A fully human pluripotent stem cell-derived blood-brain barrier model for clinically relevant disease modeling and selection of neurotropic adeno-associated viruses

    doi: 10.64898/2025.12.21.695793

    Figure Lengend Snippet: ( a ) Quantification of TEER levels shows a reduction in barrier integrity following incubation with poly(I:C) and a recovery after treatment with the CAR factors (3 biological independent experiments). ( b ) Quantification of NaFl levels confirms the recovery after treatment with the CAR factors (n=3 biological independent experiments). ( c ) Representative images and reduction of human IgG+ puncta in hPSC-derived neurons following incubation with the CAR factors (5 fields; n=3 biological independent experiments). ( d ) CAR factors reverse the mesenchymal cell transition induced by Poly(I:C). ( e ) Rescue of TEER values after treatment with tocilizumab (TCZ) (n=3 biological independent experiments). ( f ) Quantification of NaFl levels confirms the recovery after treatment with the TCZ (n=3 biological independent experiments). ( g ) Representative images and quantification of human IgG+ puncta in hPSC-derived neuronal cultures following incubation with poly(I:C) with or without TCZ (5 fields; n=3 biological independent experiments). ( h ) TCZ treatment is sufficient to rescue the endothelial-specific gene expression as confirmed by qPCR analysis. Values are mean ± SEM. *p < 0.05, ****p < 0.0001. Statistical analysis is performed using one-way ANOVA followed by Tukey post-test. Scale bars, 100 µm. CAR: CHIR99021 (C), db-cAMP (A), RepSox (R); TCZ: Tocilizumab.

    Article Snippet: For the CAR or tocilizumab (TCZ) treatment the medium was replaced with fresh medium with dbcAMP (Selleckchem, 250 μM), RepSox (10 μM, Sigma) and CHIR99021 (10 μM, Miltenyi), (CAR factor combination) or tocilizumab (50 ng/mL, BioXCell) for 48 hrs.

    Techniques: Incubation, Derivative Assay, Gene Expression